CRISPResso2

Analysis of genome editing outcomes from deep sequencing data

CRISPResso2 run information

CRISPResso version: 2.0.17b

Run completed: 2018-11-13 16:49:47

Amplicon sequence:

CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC

Guide sequence:

GGAATCCCTTCTGCAGCACC

Command used:

CRISPResso -o CRISPRessoBatch_on_batch --name FANCF_BE1 --needleman_wunsch_gap_extend -2 --max_rows_alleles_around_cut_to_plot 50 --aln_seed_count 5 --amplicon_name Reference --fastq_r1 SRR3305543.fastq.gz --quantification_window_size 20 --quantification_window_center -10 --trimmomatic_options_string NexteraPE-PE.fa:0:90:10:0:true MINLEN:40 --conversion_nuc_from C --min_bp_quality_or_N 0 --default_min_aln_score 60 --needleman_wunsch_gap_incentive 1 --needleman_wunsch_aln_matrix_loc EDNAFULL --aln_seed_min 2 --needleman_wunsch_gap_open -20 --guide_seq GGAATCCCTTCTGCAGCACC --aln_seed_len 10 --conversion_nuc_to T --base_editor_output --min_single_bp_quality 0 --exclude_bp_from_left 15 --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC --min_average_read_quality 0 --amplicon_min_alignment_score 60 --min_frequency_alleles_around_cut_to_plot 0.2 --exclude_bp_from_right 15 --plot_window_size 40 --write_cleaned_report

Parameters:

aln_seed_count: 5
aln_seed_len: 10
aln_seed_min: 2
amplicon_min_alignment_score: 60
amplicon_name: Reference
amplicon_seq: CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC
auto: False
base_editor_output: True
coding_seq: 
conversion_nuc_from: C
conversion_nuc_to: T
crispresso1_mode: False
debug: False
default_min_aln_score: 60
discard_indel_reads: False
dump: False
exclude_bp_from_left: 15
exclude_bp_from_right: 15
expand_ambiguous_alignments: False
expected_hdr_amplicon_seq: 
fastq_r1: SRR3305543.fastq.gz
fastq_r2: 
file_prefix: 
guide_seq: GGAATCCCTTCTGCAGCACC
ignore_deletions: False
ignore_insertions: False
ignore_substitutions: False
keep_intermediate: False
max_paired_end_reads_overlap: None
max_rows_alleles_around_cut_to_plot: 50
min_average_read_quality: 0
min_bp_quality_or_N: 0
min_frequency_alleles_around_cut_to_plot: 0.2
min_paired_end_reads_overlap: None
min_single_bp_quality: 0
name: FANCF_BE1
needleman_wunsch_aln_matrix_loc: EDNAFULL
needleman_wunsch_gap_extend: -2
needleman_wunsch_gap_incentive: 1
needleman_wunsch_gap_open: -20
no_rerun: False
output_folder: CRISPRessoBatch_on_batch
plot_window_size: 40
quantification_window_center: -10
quantification_window_coordinates: None
quantification_window_size: 20
save_also_png: False
split_paired_end: False
suppress_report: False
trim_sequences: False
trimmomatic_options_string: NexteraPE-PE.fa:0:90:10:0:true MINLEN:40
write_cleaned_report: True

Allele assignments
Nucleotide composition
Modification lengths
Allele plots