CRISPResso2

Analysis of genome editing outcomes from deep sequencing data

CRISPResso2 run information

Data: Mapping statistics

CRISPResso version: 2.0.29

Run completed: 2019-06-06 14:34:43

Amplicon sequence:

GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG

Guide sequence:

GAGTCCGAGCAGAAGAAGAA

Command used:

CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 20 --quantification_window_center -10 --base_editor_output --write_cleaned_report --place_report_in_output_folder

Parameters:

aln_seed_count: 5
aln_seed_len: 10
aln_seed_min: 2
amplicon_min_alignment_score: 
amplicon_name: Reference
amplicon_seq: GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG
auto: False
base_editor_output: True
coding_seq: 
conversion_nuc_from: C
conversion_nuc_to: T
crispresso1_mode: False
debug: False
default_min_aln_score: 60
discard_indel_reads: False
dump: False
exclude_bp_from_left: 15
exclude_bp_from_right: 15
expand_ambiguous_alignments: False
expected_hdr_amplicon_seq: 
fastq_r1: base_editor.fastq.gz
fastq_r2: 
file_prefix: 
flash_command: flash
guide_seq: GAGTCCGAGCAGAAGAAGAA
ignore_deletions: False
ignore_insertions: False
ignore_substitutions: False
keep_intermediate: False
max_paired_end_reads_overlap: 100
max_rows_alleles_around_cut_to_plot: 50
min_average_read_quality: 0
min_bp_quality_or_N: 0
min_frequency_alleles_around_cut_to_plot: 0.2
min_paired_end_reads_overlap: 10
min_single_bp_quality: 0
name: 
needleman_wunsch_aln_matrix_loc: EDNAFULL
needleman_wunsch_gap_extend: -2
needleman_wunsch_gap_incentive: 1
needleman_wunsch_gap_open: -20
no_rerun: False
output_folder: 
place_report_in_output_folder: True
plot_window_size: 20
quantification_window_center: -10
quantification_window_coordinates: None
quantification_window_size: 20
save_also_png: False
split_paired_end: False
stringent_flash_merging: False
suppress_plots: False
suppress_report: False
trim_sequences: False
trimmomatic_command: trimmomatic
trimmomatic_options_string: 
write_cleaned_report: True

Running log

Allele assignments

Data: Quantification of editing

Data: Quantification of editing

Nucleotide composition

Data: Nucleotide frequency table

Data: Nucleotide frequency in quantification window

Modification lengths

Data: Indel histogram

Data: Modification frequency

Data: Modification frequency in quantification window

Allele plots

Data: Allele frequency table

Data: Nucleotide frequencies

Data: Nucleotide frequencies

Data: Nucleotide frequencies in quantification window

Data: Nucleotide frequencies at Cs

Data: Nucleotide frequencies at Cs

Data: Nucleotide frequencies at Cs