Analysis of genome editing outcomes from deep sequencing data

CRISPResso2 run information

Data: Mapping statistics

CRISPResso version: 2.0.29

Run completed: 2019-06-06 14:35:29

Amplicon sequence:


Guide sequence:


Command used:

CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG --write_cleaned_report --place_report_in_output_folder


aln_seed_count: 5
aln_seed_len: 10
aln_seed_min: 2
amplicon_name: Reference
amplicon_seq: acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta
auto: False
base_editor_output: False
coding_seq: atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag
conversion_nuc_from: C
conversion_nuc_to: T
crispresso1_mode: False
debug: False
default_min_aln_score: 60
discard_indel_reads: False
dump: False
exclude_bp_from_left: 15
exclude_bp_from_right: 15
expand_ambiguous_alignments: False
expected_hdr_amplicon_seq: acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta
fastq_r1: hdr.fastq.gz
flash_command: flash
ignore_deletions: False
ignore_insertions: False
ignore_substitutions: False
keep_intermediate: False
max_paired_end_reads_overlap: 100
max_rows_alleles_around_cut_to_plot: 50
min_average_read_quality: 0
min_bp_quality_or_N: 0
min_frequency_alleles_around_cut_to_plot: 0.2
min_paired_end_reads_overlap: 10
min_single_bp_quality: 0
needleman_wunsch_aln_matrix_loc: EDNAFULL
needleman_wunsch_gap_extend: -2
needleman_wunsch_gap_incentive: 1
needleman_wunsch_gap_open: -20
no_rerun: False
place_report_in_output_folder: True
plot_window_size: 20
quantification_window_center: -3
quantification_window_coordinates: None
quantification_window_size: 1
save_also_png: False
split_paired_end: False
stringent_flash_merging: False
suppress_plots: False
suppress_report: False
trim_sequences: False
trimmomatic_command: trimmomatic
write_cleaned_report: True

Running log

Allele assignments

Data: Quantification of editing

Data: Quantification of editing

Global frameshift analysis
Global frameshift mutagenesis profiles
Global splicing analysis

Reads are aligned to each amplicon sequence separately. Quantification and visualization of these reads are shown for each amplicon below:
